Skip to main content

Table 1 Sequences of primers

From: Interleukin 32γ (IL-32γ) is highly expressed in cutaneous and mucosal lesions of American Tegumentary Leishmaniasis patients: association with tumor necrosis factor (TNF) and IL-10

Cytokine Sense Anti-sense
IL-32α 5′GCTGGAGGACGACTTCAAAGA3′ 5′GGGCTCCGTAGGACTTGTCA3′
IL-32β 5′CAGTGGAGCTGGGTCATCTCA3′ 5′GGGCCTTCAGCTTCTTCATGTCATCA3′
IL-32γ 5′AGGCCCGAATGGTAATGCT3′ 5′CCACAGTGTCCTCAGTGTCACA3′
IL-32δ 5′TCTGTCTCTCTCGGGTCCTCTCT3′ 5′TGTCTCCAGGTAGCCCTCTTTG3′
IL-10 5′GGTTCGCAAGCCTTGTCTGA 3′ 5′TCCCCCAGGGAGTTCACAT 3′
TNF 5′AAGCCTGTAGCCCATGTTGT 3′ 5′CAGATAGATGGGCTCATACC 3′
GAPDH 5′CTCAAGATTGTCAGCAATGC 3′ 5′ CAGGATGCCCTTTAGTGGGC 3′
  1. Sequences of primers used to detect cytokine mRNA by using qPCR in leishmaniasis lesions and control tissues.