Skip to main content

Table 1 List of in-house primers used for pol genome amplification and genotypic drug-resistance testing

From: Clade homogeneity and Pol gene polymorphisms in chronically HIV-1 infected antiretroviral treatment naive patients after the roll out of ART in Ethiopia

Name Sequence Position* Use
HIVrt 5’TGTTTTACATCATTAGTGTG 3’ 3630–3649 Pol/outer
HIVpcrFor1 5’TGATGACAGCATGTCAGGGAGTGG 3’ 1826–1849 Pol/outer
HIVpcrRev1 5’GGCTCTTGATAAATTTGATATGTCCATTG3’ 3555–3583 Pol/outer
HIVpcrFor2 5’AGCCAACAGCCCCACCAG 3’ 2150–2167 Pol/inner
HIVpcrRev2 5’CTGTATTTCTGCTATTAAGTCTTTTG 3’ 3514–3539 Pol/inner
HIVseq1 5’GTTAAACAATGGCCATTGACAGA 3’ 2610–2632 Pol/inner
HIVseq2 5’TGGAAAGGATCACCAGCAATATT 3’ 3006–3028 Pol/inner
HIVseq3 5’GGGCCATCCATTCCTGGCT 3’ 2584–2605 Pol/inner
HIVseq4 5’CCATCCCTGTGGAAGCACATT 3’ 2988–3008 Pol/inner
  1. *All positions are matched to HIV-1HXB2 (GenBank Accession number K03455).