Skip to main content

Table 2 PCR primers used in RT-PCR analysis

From: Cross-sectional study of the relationship of peripheral blood cell profiles with severity of infection by adenovirus type 55

Target Direction Sequence (5′→3′) Product size (bp)
Universal Forward TTCCCCATGGCICAYAACAC 482
Reverse CCCTGGTAKCCRATRTTGTA
Hexon Forward TTGACTTGCAGGACAGAAA 590
Reverse CTTGTATGTGGAAAGGCAC
Fiber Forward TACCCCTATGAAGATGAAAGCA 1064
  Reverse GGAGGCAAAATAACTACTCG