Skip to main content

Table 1 Primers used for detection of PVL-, FnBPA-, and ET-encoding genes by PCR

From: Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes

Gene Primer Primer sequence (5’ – 3’) Amplicon size (bp) Reference
mecA mecA-F GTAGAAATGACTGAACGTCCGATAA 310 McClure et al. 2006 [13]
mecA-R CCAATTCCACATTGTTTCGGTCTAA
fnbA fnbA-F CACAACCAGCAAATATAG 1362 Peacock et al. 2002 [14]
fnbA-R CTGTGTGGTAATCAATGTC
eta eta-F ACTGTAGGAGCTAGTGCATTTGT 190 Jarraud et al. 2002 [15]
eta-R TGGATACTTTTGTCTATCTTTTTCATCAAC
etb etb-F ATACACACATTACGGATAAT 629 Yamaguchi et al. 2001 [16]
etb-R CAAAGTGTCTCCAAAAGTAT
etd etd - F CGCAAATACATATGAAGAATCTGA 452 Nakaminami et al. 2008 [17]
etd - R TGTCACCTTGTTGCAAATCTATAG
PVL components S and F lukS-PV- AGTGAACTTATCTTTCTATTGAAAAACACTC 433 Jarraud et al. 2002 [15]
  lukF-PV GCATCAASTGTATTGGATAGCAAAAGC