Skip to main content

Advertisement

Table 1 List of primers and probes used in the study

From: Mailed versus frozen transport of nasal swabs for surveillance of respiratory bacteria in remote Indigenous communities in Australia

Bacteria Designation Oligonucleotide sequence Gene Reference
Streptococcus pneumoniae F primer AGCGATAGCTTTCTCCAAGTG ply [10]
  R primer CTTAGCCAAATCGTTTACCG   
  Probe FAM*-ACCCCAGCAATTCAAGTGTTCGCG- BHQ1§   
Moraxella catarrhalis F primer GTGAGTGCCGCTTTTACAA copB [11]
  R primer CCGTGAGTGCCGCTTTTACAACC   
  Probe FAM –TGCTTTTGCAGCTGTTAGCCAGCCTAA- BHQ1   
Haemophilus influenzae F primer GGTTAAATATGCCGATGGTGTTG hpd3 [12]
  R primer TGCATCTTTACGCACGGTGTA   
  Probe    
Haemophilus influenza F primer CCAGCTGCTAAAGTATTAGTAGAAG p6 [13]
  R primer TTCACCGTAAGATACTGTGCC   
  Probe FAM- CAGATGCAGTTGAAGGTTATTTAG–BHQ1   
Staphylococcus aureus Staphylococcus aureus GTTGCTTAGTGTTAACTTTAGTTGTA nuc [14]
  Staphylococcus aureus AATGTCGCAGGTTCTTTATGTAATTT   
  Probe FAM- AAGTCTAAGTAGCTCAGCAAATGCA–BHQ1   
MRSA Ŧ mec2-F mec2-F SCCmec [9]
  mec3-F ATTTCATATATGTAATTCCTCCACATCTC   
  mec4-F CAAATATTATCTCGTAATTTACCTTGTTC   
  mec5-F CTCTGCTTTATATTATAAAATTACGGCTG   
  mec7-F CACTTTTTATTCTTCAAAGATTTGAGC   
  orfX-R GGATCAAACGGCCTGCACA   
  Probe FAM-CRTAGTTACTRCGTTGTAAGACGTC-BHQ1   
Bordetella pertussis F primer ATCAAGCACCGCTTTACCC IS 481 [15]
  R primer TTGGGAGTTCTGGTAGGTGTG   
  Probe FAM- AATGGCAAGGCCGAACGCTTCA–BHQ1   
  1. *FAM = 6-Carboxyfluorescein §BHQ1 = Black Hole Quencher-1 ŦMRSA = Methicillin resistant S. aureus.