Skip to main content

Table 1 Primers and probes targeting RNA or DNA of diarrheagenic agents

From: Comparison of rectal swabs and faeces for real-time PCR detection of enteric agents in Rwandan children with gastroenteritis

Agent Forward primer Reverse primer Probe Target gene Ref
Norovirus GG2 TGGAYTTTTAYGTGCCCAG CGACGCCATCTTCATTCAC AGCCAGATTGCGATCGCCC Polymerase-capsid junction [16]
Rotavirusa AACCATCTACACATGACCCTCTATGA GGTCACATAACGCCCCTATAGC CAATAGTTAAAAGCTAACACTGTCAAA Non-strutural protein 3 [17]
  AACCATCTTCACGTAACCCTCTATGA     
Adenovirus GCCACGGTGGGGTTTCTAAACTT GCCCCAGTGGTCTTACATGCACATC TGCACCAGACCCGGGCTCAGGTACTCCGA Hexon [15]
Campylobacter jejuni ATGCAAACCATAATTGGGTTTCAAC CGAGTATCAGCAACTTCTTCTACAGCT TTGCCACCAAAACCAAAACT Fibronectin-binding protein (cadF) [18]
ETEC-estA AAGCATGAATAGTAGCAATTACTGCT TTAATAGCACCCGGTACAAGCA AACAACACAATTCAC Heat-stable enterotoxin [19]
ETEC-eltB TCCGGCAGAGGATGGTTACA CCAGGGTTCTTCTCTCCAAGC AGCAGGTTTCCCACCGGATCACC Heat-labile enterotoxin [20]
E. coli eae ACATGACCGATGACAAGGCA CGCGACTGAAGCTGGCTAC TCGCCGCCTGTTGTGCCG Enteroaggregative factor [21]
E. coli bfpA GGTCTGTCTTTGATTGAATCTGCA GCAGACTGGTAGTAAAACATCACACC GCGCTTGCTGCCACCGTTACCG Bundle-forming pilus [22]
Shigella spp ACCGGCGCTCTGCTCTC GCAATGTCCTCCAGAATTTCG CTGGGCAGGGAAATGTTCCGCC Invasion plasmid antigen H [23]
Cryptosporidium parvum/hominis CAAATTGATACCGTTTGTCCTTCTG TGGTGCCATACATTGTTGTCCT TGTCCTCCTGGATTCA Oocyst wall protein (OWP) [24]
  1. aTwo forward primers were used for rotavirus.
  2. GG2, genogroup 2, ETEC, enterotoxinogenic E. coli.