Skip to main content

Table 1 List of primers used to amplify streptococcal superantigen genes, 16S ribosomal RNA (rRNA), and emm genes

From: Fournier’s gangrene of the penis caused by Streptococcus dysgalactiae subspecies equisimilis: case report and incidence study in a tertiary-care hospital

Name Sequence 5′-3′ Source
SpeA forward AAAGTTGCCATCTCTTGGTTC Sigma genosys
SpeC forward TTTGAGCAGGCGTAATTCCT Sigma genosys
SpeG forward ACCCCATGCGATTATGAAAA Sigma genosys
SpeG reverse GGGAGACCAAAAACATCGAC Sigma genosys
SpeH reverse TGAGCGGTTACTTTCGGTTT Sigma genosys
SpeI forward TCCGCCATTTTCAGGTAGTT Sigma genosys
SpeI reverse TTTCCTTCCTCAAAGCCAGA Sigma genosys
SpeJ forward GCTCTCGACCTCAGAATCAA Sigma genosys
SpeJ reverse CTTTCATGGGTACGGAAGTG Sigma genosys
SpeK forward CAAACAAGGAACGCAATTGAT Sigma genosys
SpeK reverse GTGTCTAATGCCACCGTCT Sigma genosys
SpeL reverse AAATCTCCCGTTACCTTCCA Sigma genosys
SpeM reverse TGCTGTGTTGGTTAATAGCGA Sigma genosys
SmeZ forward TTTCTCGTCCTGTGATTGGA Sigma genosys
SmeZ reverse AATGGGACGGAGAACATAGC Sigma genosys
16S rRNA forward AGAGTTTGATCCTGGCTCAG Invitrogen life technologies
16S rRNA reverse AAGGAGGTGATCCAGCCGCA Invitrogen life technologies
emm genotyping primer forward TATTCGCTTAGAAAATTAA Invitrogen life technologies
emm genotyping primer reverse GCAAGTTCTTCAGCTTGTTT Invitrogen life technologies