Skip to main content

Table 1 PCR assays selected for screening reference isolates

From: Detection of group a streptococcal pharyngitis by quantitative PCR

Target Primer and probe sequences (5’-3’)* Product size (nt) Reference
speB 1F: GGTTCTGCAGGTAGCTCTCG 346 [17]
1R: TGCCTACAACAGCACTTTGG
2F: CTAAACCCTTCAGCTCTTGGTACTG 77 This study
2R: TTGATGCCTACAACAGCACTTTG
  probe: Cy3-CGGCGCAGGCGGCTTCAAC-BHQ2   
parE 1F: CAACAGATGCTACGGGATTGCAC 139 [18]
1R: GTCAGTGTGGCAGATAGCGGACG
spy1258 1F: AAAGACCGCCTTAACCACCT 450 [19]
1R: TGGCAAGGTAAACTTCTAAAGCA
2F: ACCTCAAATTTCCGCAACTC 141 This study
2R: TGCTCTCAATACTGGCAAGG
  probe: Cy3-TGGTTTCCAAGACATTGTGACCAATCA-BHQ2   
spy1857 1F: CCTGCACCTGACATTTCAAC 155 This study
1R: GAAGGTATTGAAGGCCGTGT
  1. *probes used for quantitative PCR assays only.