Skip to main content

Table 2 The most abundantly cloned tRF-5s.

From: Compartmentalized, functional role of angiogenin during spotted fever group rickettsia-induced endothelial barrier dysfunction: evidence of possible mediation by host tRNA-derived small noncoding RNAs

  Sequence Parental Relative cloning frequency (‰)
Mock Ricketsia infection
day 1 day 3
tRF5-ValGTG GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCT* tRNA-Val GTG, tRNA Val GTY 3.984 6.494 12.950
tRF5-GlyGCC GCATTGGTGGTTCAGTGGTAGAATTCTCGC* tRNA-Gly-GYY, tRNA-Gly-GGG 4.767 5.734 7.638
tRF5-GlyGCC (A to C) GCCTTGGTGGTTCAGTGGTAGAATTCTCGC tRNA-Gly-GYY, tRNA-Gly-GGG 2.977 3.954 4.791
tRF5-GluCTC TCCCTGGTGGTCTAGTGGTTAGGATTCGGC tRNA-Glu-GAG 0.700 0.501 1.108
tRF5-LysCTT TCCCTGGTGGTCTAGTGGTTAGGATTCGGC tRNA-Lys-AAG 0.429 0.577 1.144
  1. For individual tRF-5 sequences, their relative cloning frequencies were calculated as described in the Figure 6 legend. Based on the value (expressed in ‰ [1 per 1,000]), the most abundantly cloned tRF-5s were selected and tabulated. Among the five tRF-5s, two (tRF5-ValGTG and tRF5-GlyGCC: highlighted by asterisks in their sequences) were chosen for further study. “tRF5-GlyGCC (A to C)” has been assigned as a tRF-5, because we failed to find its identical sequence in any database and it mapped to tRF5-GlyGCC perfectly, except that the third nucleotide was C while the correct one in the mouse genome database is A.