Skip to main content

Table 1 Oligonucleotides primers used for enterococci

From: Nasal and perirectal colonization of vancomycin sensitive and resistant enterococci in patients of paediatrics ICU (PICU) of tertiary health care facilities

Primer designation Sequences (5 → 3) Product size (bp) Company Reference
E. faecium
ddl E. faecium(1) TTGAGGCAGACCAGATTGACG 658 Alpha DNA/Sigma Kariyama et al., 2000
ddl E. faecium(2) TATGACAGCGACTCCGATTCC    
E. faecalis
ddl E.faecalis(1) ATCAAGTACAGTTAGTCT 941 Alpha DNA/Sigma Kariyama et al., 2000
ddl E. faecalis(2) ACGATTCAAAGCTAACTG    
vanA (1) GGGAAAACGACAATTGC 732 Alpha DNA/e-Oligo Kariyama et al., 2000
vanA (2) GTACAATGCGGCCGTTA    
vanB (1) GTGCTGCGAGATACCACAGA 635 Alpha DNA/e-Oligo Kariyama et al., 2000
vanB (2) CGAACACCATGCAACATTTC