Skip to main content

Table 1 Primers and probes used to detect TSPyV and MCPyV

From: Merkel cell polyomavirus and trichodysplasia spinulosa-associated polyomavirus DNAs and antibodies in blood among the elderly

Virus Primers & probes sequence (5-->3) Region Amplicon size
MCPyV FWD-CCACAGCCAGAGCTCTTCCT LT 140
REV-TGGTGGTCTCCTCTCTGCTACTG
FAM-TCCTTCTCAGCGTCCCAGGCTTCA-TAMRA
MCPyV FWD-TGCCTCCCACATCTGCAAT VP1 59
REV-GTGTCTCTGCCAATGCTAAATGA
6FAM-TGTCACAGGTAATATC-MGBNFQ
TSPyV FWD-TGTGTTTGGAAACCAGAATCATTTG LT 140
REV-TGCTACCTTGCTATTAAATGTGGAG
FAM-TTCTTCTTCCTCCTCATCCTCCACCTCAAT-BHQ1
TSPyV FWD-AGTCTAAGGACAACTATGGTTACAG VP1 140
REV-ATTACAGGTTAGGTCCTCATTCAAC
FAM-ACAGCAGTGACCAGGACAAGCCTACTTCTG-BHQ1
Tail Sequence AACTGACTAAACTAGGTGCCACGTCGTGAAAGTCTGACAAGTGTCTCTGCCAA TGCTAAATGA