Skip to main content

Table 1 Primer sequences and probes used in real-time PCR assay

From: Excessive proinflammatory cytokine and chemokine responses of human monocyte-derived macrophages to enterovirus 71 infection

Gene Primer and probe sequence (5′to3′) Product length(bp) GenBank
β-actin (R) CAAGTACTCCGTGTGGATCG 90 NM_001101.3