Skip to main content

Table 1 Polymorphism-Specific PCR. Primer sequences and expected size of amplicons

From: Polymorphism-specific PCR enhances the diagnostic performance of American tegumentary leishmaniasis and allows the rapid identification of Leishmania species from Argentina

  Sequence Amplicon size
Primers Forward Reverse (bp)
V1– V2 5’GCTTCTCGTTTCGCTTTGAAC3′ 5′-CAAGACAAGAAAAAAGGCGGC-3′ 168
M1– M2 5′CCAGTTTCGAGCCCCGGAG-3′ 5′-GGTGTAAAATAGGGGCGGATGCTCTG-3′ 700
b1-b2 5′-GTGGGCGTATCTGCTGATGAC-3′ 5′-CAAAAAGCGAGGGACTGCGGA-3′ 103
p1-p2 5′-GGTCGGATCTGCATGCATCAC-3′ 5′-CAAAAAGCGAGGGACTGCGGG-3′ 79
g1-g2 5′-GGTCGGATCTGCATGCATCAT3′ 5′-CAAAAAGCGAGGGACTGCGGG-3′ 79
GAPDH 5′-CGGGAAGCTTGTGATCAATGG-3′ 5′-GGCAGTGATGGCATGGACTG-3′ 862