Skip to main content

Table 1 Primer information

From: The development of a GeXP-based multiplex reverse transcription-PCR assay for simultaneous detection of sixteen human respiratory virus types/subtypes

Primer Sequence 5’-3’ Gene Size (bp)
FluA F AGGTGACACTATAGAATATTCTAACCGAGGTCGAAACG M 270
FluA R GTACGACTCACTATAGGGAACAAAGCGTCTACGCTGCAG
FLuB F AGGTGACACTATAGAATAAAAAGRAGATTCATCACAGAGC M 166
FLuB R GTACGACTCACTATAGGGATTCTGCTATTTCAAATGCTTCA
sH1N1 F AGGTGACACTATAGAATAGGTATGCTTTTGCAMTGARTAGAGG HA 250
sH1N1 R GTACGACTCACTATAGGGAAAGGGATATTCCTTARTCCTGTARCCAT
PIV1 F AGGTGACACTATAGAATATCTCATTATTACCYGGACCAA HA 284
PIV1 R GTACGACTCACTATAGGGATCCTGTTGTCGTTGATGTCATA
PIV2 F AGGTGACACTATAGAATATCTACACTGCATCAGCCAGC HA 194
PIV2 R GTACGACTCACTATAGGGACCCCTAAAAGAGATGAGCCC
PIV3 F AGGTGACACTATAGAATATTGTCAATTATGATGGYTCAATCT HA 230
PIV3 R GTACGACTCACTATAGGGAGACACCCAGTTGTGTTGCAG
HRV F AGGTGACACTATAGAATACCCCTGAATGYGGCTAACCT 5' UTR 144
HRV R GTACGACTCACTATAGGGACGGACACCCAAAGTAGTYGGT
HMPV F1 AGGTGACACTATAGAATACATGCCCACTATAAAAGGTCAG L 208
HMPV R1 GTACGACTCACTATAGGGACACCCCAGTCTTTCTTGAAA
HMPV F2 AGGTGACACTATAGAATAGAGCTAAYAGAGTGCTAAGTGATG N 208
HMPV R2 GTACGACTCACTATAGGGAACTTTCTGCTTTGCTTCCTGT
Adv F AGGTGACACTATAGAATAGCCSCARTGGKCWTACATGCACATC Hexon 338
Adv R GTACGACTCACTATAGGGACAGCACSCCICGRATGTCAAA
NL63 F AGGTGACACTATAGAATATCCCAAATGTGATAGAGCTTTGC Polym-erase 176
NL63 R GTACGACTCACTATAGGGACTGTTAAAACTTGTGCCAACTC
OC43 F AGGTGACACTATAGAATAATTGCACCAGGAGTCCCA N 200
OC43 R GTACGACTCACTATAGGGATATCGGTGCCGTACTGGTCT
229E F AGGTGACACTATAGAATACTCGGAATCCTTCAAGTGACAGA N 183
229E R GTACGACTCACTATAGGGAACGAGAAGGCTTAGGAGTAC
HKU1 F AGGTGACACTATAGAATATATAGTRAAACCTGATATGGCT N 220
HKU1 R GTACGACTCACTATAGGGATACCAAAACACTGTTGAACAT
RSVA F AGGTGACACTATAGAATACATCCCCTCTATGCACAACC F 158
RSVA R GTACGACTCACTATAGGGACATGTTTCAGCTTGTGGGAA
RSVB F AGGTGACACTATAGAATAAAACGAAGATTTCTGGGCTTC F 279
RSVB R GTACGACTCACTATAGGGATGCGACAGCTCTGTTGATTT
HBoV F AGGTGACACTATAGAATAAAGAAAAGGGAGTCCAGAA NP1 290
HBoV R GTACGACTCACTATAGGGACTCTGTGTTGACTGAATACAG
Rnasep F AGGTGACACTATAGAATAGAGGCCTGGCTTTTGAACTT RNase P 125
Rnasep R GTACGACTCACTATAGGGAATCAAATTGAGGGCACTGGA
Tag F AGGTGACACTATAGAATA   
Tag R GTACGACTCACTATAGGGA   
  1. a The primers HMPV F1 and HMPV R1 were reported previously [14]; the primers Adv F and Adv R were reported previously [15]; the primer HBoV R was reported previously [16]. The Universal Tag sequences are underlined.