Skip to main content

Table 2 Oligonucleotide probes used to identify airborne fungi

From: Rapid identification of allergenic and pathogenic molds in environmental air by an oligonucleotide array

Microorganism Probe   
  Codea Sequence (5'-3')b Length (nt) T m (℃) Locationc GenBank accession no.
Acremonium strictum d Acstr2-5 CTGCGTAGTAGCACAACCTCGCAtttttttttt 23 59.1 431-453 (2) AJ621771
Alternaria alternata e Alalt3 CGCACTCTCTATCAGCAAAGGTCTAGCATC 30 63.5 461-490 (2) AY625056
Aspergillus flavus e Asfla4 CGAACGCAAATCAATCTTTTTCCAGGT 27 63.1 512-538 (2) AY373848
Aspergillus fumigatus e Asfum2-1 GCCAGCCGACACCCAACTTTATTTTTCTAAtttttttttt 30 65.4 213-242 (2) AY230140
Aspergillus niger e Asnig2 ACGTTTTCCAACCATTCTTTCCAGGT 26 60.9 517-542 (2) AY373852
Aspergillus versicolor e Asver4 ACGTCTCCAACCATTTTCTTCAGGT 25 58.2 486-510 (2) AY830119
Aureobasidium pullulans e Aupul2 ATTTCTAACAACGCTCTTTGGGTCGGTACG 30 65.5 454-483 (2) AF121283
Aureobasidium pullulans e Aupul3 TCAAAGGAGAGGACTTCTGCCGACTGAAAC 30 66.2 456-485 (2) AY139395
Aureobasidium pullulans e Aupul4 GGCGTAGTAGAATTTATTCGAACGTCTGTC 30 60.7 428-457 (2) AY139395
Chaetomium cochliodes/C. globosum/C. funicola e Chcgf1 GGCCTCTCTGAGTCTTCTGTACTGAATAAG 30 58.8 157-186 (1) AJ279450
Cladosporium cladosporioides Ccla2-2 CGGGAGGCTACGCCGTAAAtttttttttt 19 57.4 470-488 (2) AY361994
Mucor racemosus Mrac2-1 GGGCCTCTCGATCTGTATAGATCTTtttttttttt 25 55.3 573-597 (2) AY625074
Mucor racemosus Mrac3-1 TAGATCTTGAAATCCCTGAAATTTACTtttttttttt 27 52.7 590-616 (2) AY625074
Paecilomyces variotii f Pavar2 CCGAAGACCCCTSGAACGCtttttttttt 19 59.0 155-173 (1) AY373941
Penicillium brevicompactum Pbre1-1 ACCCGCTTTGTAGGACTGCCCGtttttttttt 22 63.0 439-461 (2) AY484922
Penicillium chrysogenum Pchr1-1 TCAACCCAAATTTTTATCCAGGtttttttttt 22 52.6 482-503 (2) DQ674380
Penicillium corylophilum Pcor1-2R CGCGGGCCAGAGGGCAGAtttttttttttt 18 63.9 102-119 (1) AF034456
Penicillium corylophilum Pcor2-2R CGCGGGCCAGAGGGCAGAAGtttttttttttt 20 65.6 100-119 (1) AF033450
Rhizopus stolonifer Rsto4 AAAGGCGGTTAATGGTATCCAACAAATtttttttttt 27 60.0 246-272 (1) AB113023
Scopulariopsis chartarum Sccha1 TCTTCATACCCATTTGTGAACACTACCCtttttttttt 28 59.4 41-68 (1) AY625066
  Sccha4-1 AGTAAAGCACCTCGCATCGGGTCCtttttttttt 24 63.2 497-520 (2) AY625066
Scopulariopsis brevicaulis e Scbre3-1 TGCGTAGTAGATCCTACATCTCGCATCGtttttttttt 28 62.4 500-527 (2) AY625065
Stachybotrys chartarum Scha1-3 CAGTATTCTCTGAGTGGGAAACGCAAAtttttttttt 27 60.7 485-511 (2) AF081468
Stachybotrys chartarum Scha1-4 AGTATTCTCTGAGTGGTAAACGCAAAtttttttttt 26 54.8 157-181 (1) AY095976
Trichoderma viride Tvir2-1 AACCAAACTCTTTCTGTAGTCCCCTCtttttttttt 26 56.5 111-136 (1) AY380909
Positive controlg PC GCATCGATGAAGAACGCAGCttttttttt 20 55.7 200-219 EF134625
  1. aOligonucleotide probes are arranged on the array as indicated in Figure 1.
  2. bMultiple bases of thymine, indicated by "t", were added to the 3' end of the probe. The underlined nucleotide indicates a single mismatch base that was intentionally incorporated into the probe to avoid cross-hybridization.
  3. cThe location of probe is shown by the nucleotide number of either ITS 1 or ITS 2; the number (1 or 2) in parenthesis indicates the ITS region from which the probe was designed.
  4. dProbe modified from a previous study (19)
  5. eProbes designed in a previous study (19)
  6. fProbe designed in a previous study (26)
  7. gThe positive control probe was designed from a conserved region of the 5.8S rRNA gene (30)