Skip to main content

Advertisement

Table 2 Primers used to amplify the tetracycline and macrolide resistance determinants and for sequencing purpose

From: The antimicrobial resistance patterns and associated determinants in Streptococcus suisisolated from humans in southern Vietnam, 1997-2008

Primer Sequence (5' - 3') Product size Position in coding sequence Reference
erm(A)-F CCCGAAAAATACGCAAAATTTCAT 590 15-38 [23]
erm(A)-R CCCTGTTTACCCATTTATAAACG   604-582  
erm(B)-F TGGTATTCCAAATGCGTAATG 745 203-183  
erm(B)-R CTGTGGTATGGCGGGTAAGT   541-522  
mef(A)-F* CAATATGGGCAGGGCAAG 317 38-55  
mef(A)-R* AAGCTGTTCCAATGCTACGG   352-333  
tet(M)-F GTGGACAAAGGTACAACGAG 406 106-125  
tet(M)-R CGGTAAAGTTCGTCACACAC   511-492  
tet(O)- F AACTTAGGCATTCTGGCTCAC 515 13-43  
tet(O)- R TCCCACTGTTCCATATCGTCA   527-507  
tet(K)-F GATCAATTGTAGCTTTAGGTGAAGG 155 344-368  
tet(K)-R TTTTGTTGATTTACCAGGTACCATT   498-474  
tet(L)-F TGGTGGAATGATAGCCCATT 229 384-403  
tet(L)-R CAGGAATGACAGCACGCTAA   612-593  
16S-rDNA-F GAGTACGACCGCAAGGTTGA 100 886-905  
16S-rDNA -R CTGGTAAGGTTCTTCGCGTTG   985-964  
ss-Tn916-1 GCCATGACCTATCTTATA 476 16083-16100 [24]
ss-Tn916-2 CTAGATTGCGTCCAA   16559-16545  
tet(32)For GAACCAGATGCTGCTCTT 620 619-637 [28]
Tet(32)Rev CATAGCCACGCCCACATGAT   1239-1220  
SScps2J-F CAAACGCAAGGAATTACGGTATC 236 209-231 [29, 30]
SScps2J-R CATTTCCTAAGTCTCGCACC   445-426  
tet(L)Ng-F TCGTTAGCGTGCTGTCATTC 698 680-700 [31]
tet(L)-R-pDG364 CTTAGAAATCCCTTTGAGAAT   1378-1358 This study
tet(W)- F TTGGAATTCTTGCCCATGTAGACGC 1872 18-42 This study
tet(W)- R TTGTCCAGGCGGTTGTTTGGAC   1889-1868  
tet(W)-F-HN GGTGCAGTTGGAGGTTGTTT 410 1179-1198  
tet(W)-R-HN CCTTCAATGCCTGTTCCAAT   1569-1588  
tet(O)-F-pDG364 ATGAAAATAATTAACTTAGG 1920 1-19  
tet(O)-R-pDG364 TTAAGCTAACTTGTGGAACA   1920-1901  
ss-tet(M)-whole-F ACAGACAAAGAACTATCCTTAATG 2500 419-396  
ss-tet(M)-whole-R GTACCCAGTTTAAGAATACCTTTATC   161-136  
Additional primers used for sequencing
tet(O)-2-F TTCAAGACGCCTCCCTGTTC   679-698 This study
tet(O)-2-R ATTTGGCGGGACTTCTATGTGG   1318-1296  
ss-tet(M)-Fseq1 GTTAAATCACTACGATAT   1763-1745  
ss-tet(M)-Rseq1 ATAGTGTTCTTGGAGATA   906-929  
ss-tet(M)-Fseq2 GTATAATTTCATGTGTCG   1162-1144  
ss-tet(M)-Rseq2 AGATGGCGTACAAGCACA   305-323  
ss-PAI-P8-tet(M)-R GCCCTTTTGGGTTTTTGAAT   -33- -14  
ss-PAItetM-P9over F GGGAATCCCCATTTTCCTAA   366-347  
  1. *: These primers were named mef(A/E) in the referenced publication.