Skip to main content

Table 1 Primers used in this study.

From: Phylogenetic and recombination analysis of human bocavirus 2

Primer Sequence Target
NP-F1(+) ATACGTGGCAGTCACAACCT NP1
NP-R1(-) CGTCTGTTAC CTCCTCTGAT NP1
NP-F2(+) ATGAGCTCCGAATCTATG NP1*
NP-R2(-) CCTCTGATTCCTGTGAAG NP1
VP-F1(+) AACGACTGGTCTCTTGGTGGCAT VP1
VP-R1(-) TGGATATGCG TGTTCACCAT CAC VP1
VP-F2(+) CGACTGGTCTSTTGGTGGCATTAT VP1 #
VP-R2(-) CGTTGTTGTA TGTAGTGTCA GCACC VP1
  1. * The target fragment of NP1 partial gene was 586 nt, in 2285-2870 nt according to HBoV2 FJ170279 strain.
  2. # The target fragment of VP1 partial gene was 620 nt, in 3134-3753 nt according to HBoV2 FJ170279 strain.
  3. The target fragment of NP1 Real-time PCR 145 nt, in 2489-2633 nt according to HBoV2 FJ170279 strain.