Skip to main content

Table 1 Primers used in this study.

From: Phylogenetic and recombination analysis of human bocavirus 2

Primer

Sequence

Target

NP-F1(+)

ATACGTGGCAGTCACAACCT

NP1

NP-R1(-)

CGTCTGTTAC CTCCTCTGAT

NP1

NP-F2(+)

ATGAGCTCCGAATCTATG

NP1*

NP-R2(-)

CCTCTGATTCCTGTGAAG

NP1

VP-F1(+)

AACGACTGGTCTCTTGGTGGCAT

VP1

VP-R1(-)

TGGATATGCG TGTTCACCAT CAC

VP1

VP-F2(+)

CGACTGGTCTSTTGGTGGCATTAT

VP1 #

VP-R2(-)

CGTTGTTGTA TGTAGTGTCA GCACC

VP1

  1. * The target fragment of NP1 partial gene was 586 nt, in 2285-2870 nt according to HBoV2 FJ170279 strain.
  2. # The target fragment of VP1 partial gene was 620 nt, in 3134-3753 nt according to HBoV2 FJ170279 strain.
  3. The target fragment of NP1 Real-time PCR 145 nt, in 2489-2633 nt according to HBoV2 FJ170279 strain.