Skip to main content

Table 1 PCR primer sequences and MIRU-VNTR locus designations1 used in this study

From: Detection of multiple strains of Mycobacterium tuberculosis using MIRU-VNTR in patients with pulmonary tuberculosis in Kampala, Uganda

Locus Alias Repeat unit length, bp PCR primer pairs (5'-3')
580 MIRU4, ETRD 77 GCGCGAGAGCCCGAACTGC
GCGCAGCAGAAACGCCAGC
2996 MIRU26 51 TAGGTCTACCGTCGAAATCTGTGAC
CATAGGCGACCAGGCGAATAG
802 MIRU40 54 GGGTTGCTGGATGACAACGTGT
GGGTGATCTCGGCGAAATCAGATA
960 MIRU10 53 GTTCTTGACCAACTGCAGTCGTCC
GCCACCTTGGTGATCAGCTACCT
1644 MIRU16 53 TCGGTGATCGGGTCCAGTCCAAGTA
CCCGTCGTGCAGCCCTGGTAC
3192 MIRU31, ETRE 53 ACTGATTGGCTTCATACGGCTTTA
GTGCCGACGTGGTCTTGAT
424 Mtub04 51 CTTGGCCGGCATCAAGCGCATTATT
GGCAGCAGAGCCCGGGATTCTTC
577 ETR C 58 CGAGAGTGGCAGTGGCGGTTATCT
AATGACTTGAACGCGCAAATTGTGA
2165 ETR A 75 AAATCGGTCCCATCACCTTCTTAT
CGAAGCCTGGGGTGCCCGCGATTT
2401 Mtub30 58 CTTGAAGCCCCGGTCTCATCTGT
ACTTGAACCCCCACGCCCATTAGTA
3690 Mtub39 58 CGGTGGAGGCGATGAACGTCTTC
TAGAGCGGCACGGGGGAAAGCTTAG
4156 QUB-4156 59 TGACCACGGATTGCTCTAGT
GCCGGCGTCCATGTT
2163b QUB-11b 69 CGTAAGGGGGATGCGGGAAATAGG
CGAAGTGAATGGTGGCAT
1955 Mtub21 57 AGATCCCAGTTGTCGTCGTC
CAACATCGCCTGGTTCTGTA
4052 QUB-26 111 AACGCTCAGCTGTCGGAT
CGGCCGTGCCGGCCAGGTCCTTCCCGAT
  1. 1: Extracted from Supply et al, [19]. Primers were synthesized by Eurofins MWG Operon, Ebersberg (Germany).