Skip to main content

Table 1 Specific T. denticol a primers sets and cycling condition used in this study.

From: The central region of the msp gene of Treponema denticola has sequence heterogeneity among clinical samples, obtained from patients with periodontitis

Primer Nucleotide Sequence Amplicon Size Cycling conditions
Dent 1
Dent 2
5'TAATACCGAATGTGCTCATTTACAT3'
5'TCAAAGAAGCATTCCCTCTTCTTCTTA3'
316 bp 36 cycles
95°C 30"
60°C 1'
72°C 1'
Kx14
Kx04
5'GCTTGACAAGTGGATTTGGCTGTG3'
5'GAGAATAGCAGCAGAGTCTATTAG3'
1777 bp 30 cycles
94°C 1'
55°C 1'
72°C 3'
Kx14
Kx09
5'GCTTGACAAGTGGATTTGGCTGTG3'
5'CGAACGTCACCTTCGGTCTTTGAG3'
294 bp 31 cycles
94°C 1'
55°C 1'
72°C 1'
Td03
Td06
5'CTCAAAGACCGAAGGTGACGTTCG3'
5'GCATATTTGTTTGCTGCG3'
571 bp 31 cycles
94°C 1'
55°C 1'
72°C 1'
Td05
Kx04
5'CCGCAGCAAACAAATATGC3'
5' GAGAATAGCAGCAGAGTCTATTAG3'
875 bp 31 cycles
94°C 1'
55°C 1'
72°C 2'