Skip to main content

Table 1 Primer sequences used in PCR for amplifying porB1A and porB1B genes

From: Predominant porB1A and porB1B genotypes and correlation of gene mutations with drug resistance in Neisseria gonorrhoeae isolates in Eastern China

Primers Sequences (5' to 3')* Products and sizes
porB1A/1B F: ATGAAAAAATCCCTGATTGCC 981 bp for entire porB1A gene, and 1044 bp for entire porB1B gene
  R: TTAGAATTTGTGGCGCAGAAC  
porB1A/1B-D F1: GCCATTTGGCAGTTGGAACA 520 bp for partial sequence of porB1A gene, and 201 bp and 583 bp for partial sequence of porB1B gene
  F2: GATACGGCGAAGGCACTAAA  
  R: CTTCGGTTTGAGAGTTGTGC  
  1. * F: forward primer, R: reverse primer