Skip to main content

Table 2 Bartonella tamiae DNA in samples was detected by PCR using Bartonella specific primers

From: Human isolates of Bartonella tamiaeinduce pathology in experimentally inoculated immunocompetent mice

Primer name Primer sequence 5'--3' Amplicon size (bp) Reference
gltA793F CATGGTGGAGCTAATGAAG 344 This article
BhCS1137n AATGCAAAAAGAACAGTAAACA   [25]
ITS325F CTTCAGATGATGATCCCAAGCCTTCTGGCG ~300 bp [26]
ITS1100R GAACCGACGACCCCCTGCTTGCAAAGCA