Skip to main content

Table 1 Primers used for the Amplification of WUPyV VP1, KIPyV VP1, and HBoV VP2

From: High prevalence of antibodies against polyomavirus WU, polyomavirus KI, and human bocavirus in German blood donors

Primer Sequence (5' - 3')a Gene Positionb Virus
WU1673s-TOPO CACCGCCTGCACAGCAAAGC VP1 1673-1688 WUPyV
WU2782a ACATTATCCTTGTGTGTTTAGTATTGGGCC VP1 2782-2753 WUPyV
KI1501s-TOPO CACCAGCTGCACCCCGTGT VP1 1501-1519 KIPyV
KI2727a CCTTACTGAGTTTGCCACTATGCA VP1 2727-2704 KIPyV
BoV3446s-TOPO CACCTCTGACACTGACATTCAAGAC VP2 3446-3466 HBoV
BoV5113a AGGAGGAACTTGTAAGCAGAAGC VP2 5113-5091 HBoV
  1. a Nucleotides added for directional cloning are underlined.
  2. b Positions according to GenBank accession number EU711057 (WUPyV), NC_009238 (KIPyV), and DQ000496 (HBoV).