Skip to main content

Table 1 PCR Primers and Results

From: Tracking the transcriptional host response from the acute to the regenerative phase of experimental pneumococcal meningitis

Name Forward Reverse Ratio Array Ratio PCR
Folate receptor 2
(XM_215013)
GATTGCCCTGGGTTGAGTCA TCACTCCTACAAGGTCAGCAACTATAG 41.7 22.3
Aquaporin 4
(NM_012825)
GCTTTCTTCTCCCAAGCACAA TCTTGCTGCCACAGACACAAA 5.8 2.6
TGF-β (NM_021578) GGAAGGGTCGGTTCATGTCA CGTGGAAATCAATGGGATCAG 2.5 2.2
  1. Primers used for the assessment of the expression level of the low abundant Folic acid receptor, the high abundant Aquaporin 4 water channel and the intermediately expressed growth factor TGF-β1.
\