Skip to main content

Table 1 Strains, plasmids and primers used.

From: Tobramycin at subinhibitory concentration inhibits the RhlI/R quorum sensing system in a Pseudomonas aeruginosaenvironmental isolate

Strains, Plasmids and Primers Characteristics Reference or source
Strains   
Pseudomonas aeruginosa   
PUPa3 Wild type, rice rhizosphere isolate [42]
LASI lasI::Km of P. aeruginosa PUPa3; Kmr [43]
RHLI rhlI::Gm of P. aeruginosa PUPa3; Gmr [43]
DMI lasI::Km rhlI::Gm of P. aeruginosa PUPa3; Kmr Gmr [43]
Pseudomonas putida   
SM17 rsaL::Tc of P. aeruginosa PUPa3; Tcr [43]
E. coli   
M15(pRep4) Derivative of E. coli K-12, containing pREP4 plasmid ensuring the production of high levels of lac repressor protein; Kmr Qiagen
DH5α F'/endA1 hsdR17 supE44 thi-1 recA1 gyrA relA1 (lacZYA-argF)U169 deoR [80dlac(lacZ)M15recA1] [44]
Plasmids   
pMP220 Promoter probe vector, IncP1; Tcr [45]
pMOSBlue Cloning vector; Ampr Amersham-Pharmacia
pGEM-T Easy Cloning vector; Ampr Promega
pBBRmcs3 Broad-host-range vector; Tcr [46]
pQE30 Expression vector, Ampr Qiagen
pRTLF-1 rpoS-lacZ translational fusion in pMP77; Cmr [47]
pSB406 contains a fusion of rhlRI'::luxCDABE in pUC18; Ampr [48]
pSB536 ahyR + ahyI::luxCDABE; ColE1 origin; Ampr [49]
pRK2013 Tra+ Mob+ ColE1 replicon; Kmr [50]
pRPO220 pMP220 containing promoter rpoS; Tcr [51]
pRSAL220 pMP220 containing promoter rsaL; Tcr [47]
pRHLI pMP220 containing promoter rhlI; Tcr This study
pLASI pMP220 containing promoter lasI; Tcr This study
pQERHLR pQE30 containing rhlR; Ampr This study
pRMTA pBBR3 containing rmtA; Tcr This study
pRMTC pBBR3 containing rmtC; Tcr This study
Primers   
RhlR-fw GGGGTACCAGGAATGACGGAGGCTTTTTG This study
RhlR-rv GAAGCTTGATGAGGCCCAGCGCCGCGG This study
rhlI-fw CCGAATTCCACCACAAGAACATCC This study
rhlI-rv ATGGTACCAGCGATTCAGAGAGCAA This study
lasI-fw GGAATTCGGGCTGTGTTCTCTCGTGTG This study
las-rv CTCTAGAGAACTCTTCGCGCCGACCAA This study
RmtA-fw GGGTACCAATAATTTTGTTTAACTTTA [52]
RmtA-rv CCCTCGAGTCACTTATTCC This study
RmtC-fw ATCTGCAGAATAATTTTGTTTAACTTTA This study
RmtC-rv ATACTAGTTTACAATCTCGATACGAT This study
  1. Apr, Kmr, Tcr, Gmr, and Cmr, resistant to ampicillin, kanamycin, tetracycline, gentamicin, and chloramphenicol, respectively