Skip to main content

Table 1 Used primers for the MTCD-MPCR and additional PCRs and sequencings.

From: Identification of Mycobacterium tuberculosis clinical isolates in Bangladesh by a species distinguishable multiplex PCR

Target locus Primer name Primer sequence Locationa Size (bp) Ref. No.
MTCD-MPCR     
cfp32 Rv0577F 5' ATGCCCAAGAGAAGCGAATACAGGCAA 671166-192 786 [3]
  Rv0577R 5' CTATTGCTGCGGTGCGGGCTTCAA 671951-928   
RD9 Rv2073cF 5' TCGCCGCTGCCAGATGAGTC 2330579-598 600 [3]
  Rv2073cR 5' TTTGGGAGCCGCCGGTGGTGATGA 2331173-150   
RD12 Rv3120F 5' GTCGGCGATAGACCATGAGTCCGTCTCCAT 3485558-587 404 [3]
  Rv3120R (390-369) 5' GCGAAAAGTGGGCGGATGCCAG 3485961-940   
Additional PCRs or sequencings    
cfp32 3'cfp32F 5' CGAATCATTGGCACGTCTACTTTG 671770-793 372 [2]
  3'cfp32R 5' GTGGCACCGGCGGCACCGCACACCT 672141-117   
RD12 Rv3120-F (90-110) 5' GGTATTTGCGCCCATATCCTG 3485661-681 411 this study
  Rv3120-R (500-481) 5' CCTGGCTTCAAGCACCATTC 3486071-052   
rpoB rpoB-Fb 5' CAGGACGTGGAGGCGATCAC 761007-026 250 [18]
  rpoB-R 5' CAGGGGTTTCGATCGGGCAC 761256-237   
rpoB c rpoB-S-Fb 5' GCGTACGGTCGGCGAGCTGATCC 760922-944 418 this study
  rpoB-S-R 5' GCGGTACGGCGTTTCGATGAACC 761339-317   
rrs Bact-rrs-Fb 5' AGAGTTTGATCCTGGCTCAG 1471856-875 1496 this study
  Bact-rrs-R 5' TACGGCTACCTTGTTACGAC 1473351-332   
rrs c rrs-S-Fb 5' ATACCTTTGGCTCCCTTTTCC 1471809-829 1607 this study
  rrs-S-R 5' CCCACCAGTTGGGGCGTTTTC 1473415-395   
hsp65 hsp65Fb 5' ACCAACGATGGTGTGTCCAT 528752-771 441 [2]
  hsp65R 5' CTTGTCGAACCGCATACCCT 529192-173   
gyrB gyrBFb 5' ACATCAACCGCACCAAGAACGC 6027-048 483 this study
  gyrBR 5' GTGCCTTACGTGCCGCGATACG 6509-488   
  1. aLocation on the M. tuberculosis H37Rv genome (accession no. NC_000962.2).
  2. bThese primers were used for PCR and sequencing.
  3. cThose primer pairs were used for the samples that showed non-MTC gene sequences.